cav3

Ensembl ID:
ENSDARG00000024141
ZFIN ID:
ZDB-GENE-050522-426
Description:
caveolin-3 [Source:RefSeq peptide;Acc:NP_991301]
Human Orthologue:
CAV3
Human Description:
caveolin 3 [Source:HGNC Symbol;Acc:1529]
Mouse Orthologue:
Cav3
Mouse Description:
caveolin 3 Gene [Source:MGI Symbol;Acc:MGI:107570]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5380 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032527 Nonsense 72 150 2 2
Genomic Location:
Chromosome 6 (position 41927486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGGAAGGCYAGTTACACCACCTTCACCGTCTCCAAGTACTGGTGCTA[C/A]CGTGTGCTRTCAGCTGTCTTTGGCATCCCRGTGGCRCTGCTGTGGGGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/83pseu0f