p2rx8

Ensembl ID:
ENSDARG00000024139
ZFIN ID:
ZDB-GENE-030319-7
Description:
purinergic receptor P2X8 [Source:RefSeq peptide;Acc:NP_945336]
Human Orthologue:
P2RX5
Human Description:
purinergic receptor P2X, ligand-gated ion channel, 5 [Source:HGNC Symbol;Acc:8536]
Mouse Orthologue:
P2rx5
Mouse Description:
purinergic receptor P2X, ligand-gated ion channel, 5 Gene [Source:MGI Symbol;Acc:MGI:2137026]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42512 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35838 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029063 Essential Splice Site 250 391 7 12
ENSDART00000143584   None 45 None 2
Genomic Location (Zv9):
Chromosome 15 (position 15367825)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16412788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATATTGTGAGCAAAGCTGGATATAGGTTTGAAGAAGTGGCAGCAAAG[G/T]TGAGAAATTCGAGTGGATTTAATGTGTGGTGGAAGTACTAAACTTAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029063 Essential Splice Site 371 391 11 12
ENSDART00000143584 Essential Splice Site 25 45 1 2
Genomic Location (Zv9):
Chromosome 15 (position 15389942)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16434905
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTGTTTATGGTGAAGAAGAAATATGCAAAGTTTGAGAGCTTGATAAA[G/A]TATGTAATAGCAGCATGTTTCTGTGAAATACTAACGATATAGTTTGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link