gmppaa

Ensembl ID:
ENSDARG00000024112
ZFIN ID:
ZDB-GENE-040704-37
Description:
Mannose-1-phosphate guanyltransferase alpha-A [Source:UniProtKB/Swiss-Prot;Acc:Q6GMK8]
Human Orthologue:
GMPPA
Human Description:
GDP-mannose pyrophosphorylase A [Source:HGNC Symbol;Acc:22923]
Mouse Orthologue:
Gmppa
Mouse Description:
GDP-mannose pyrophosphorylase A Gene [Source:MGI Symbol;Acc:MGI:1916330]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18238 Essential Splice Site Available for shipment Available now
sa5525 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003543 Essential Splice Site 14 422 1 12
Genomic Location:
Chromosome 9 (position 10995847)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGCAAGCATGCTGAAGGCTGTCATTCTTATCGGAGGCCCCCAAAAAGG[T/G]GAGTAAACATCCGTCTGACWCTTTTCAGCAGTTCRGATTGACATYATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003543 Essential Splice Site 254 422 8 12
Genomic Location:
Chromosome 9 (position 11000404)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATTTTGTAGTTGCTGTATTATGTTAGTKATTGTTATGTTCTACTTTC[A/T]GATCTGCGATTTATGCAAGCCGTTTGTATCTGAATCAATATCAYAAGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/96l3l6hc