gmppaa

Ensembl ID:
ENSDARG00000024112
ZFIN ID:
ZDB-GENE-040704-37
Description:
Mannose-1-phosphate guanyltransferase alpha-A [Source:UniProtKB/Swiss-Prot;Acc:Q6GMK8]
Human Orthologue:
GMPPA
Human Description:
GDP-mannose pyrophosphorylase A [Source:HGNC Symbol;Acc:22923]
Mouse Orthologue:
Gmppa
Mouse Description:
GDP-mannose pyrophosphorylase A Gene [Source:MGI Symbol;Acc:MGI:1916330]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18238 Essential Splice Site Available for shipment Available now
sa41361 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003543 Essential Splice Site 14 422 1 12
Genomic Location (Zv9):
Chromosome 9 (position 10995847)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10799604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGCAAGCATGCTGAAGGCTGTCATTCTTATCGGAGGCCCCCAAAAAGG[T/G]GAGTAAACATCCGTCTGACWCTTTTCAGCAGTTCRGATTGACATYATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003543 Essential Splice Site 46 422 2 12
Genomic Location (Zv9):
Chromosome 9 (position 10996499)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 10800256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGCCGGAGTGCCAATGCTGCAGCATCACATTGAGGCCTGCTCTAAGG[T/A]AAAGTACTCATTTTACACTTTGAAAACAATATGATATATTAGCACATCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link