gmppaa

Ensembl ID:
ENSDARG00000024112
ZFIN ID:
ZDB-GENE-040704-37
Description:
Mannose-1-phosphate guanyltransferase alpha-A [Source:UniProtKB/Swiss-Prot;Acc:Q6GMK8]
Human Orthologue:
GMPPA
Human Description:
GDP-mannose pyrophosphorylase A [Source:HGNC Symbol;Acc:22923]
Mouse Orthologue:
Gmppa
Mouse Description:
GDP-mannose pyrophosphorylase A Gene [Source:MGI Symbol;Acc:MGI:1916330]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18238 Essential Splice Site Available for shipment Available now
sa41361 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5525 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003543 Essential Splice Site 14 422 1 12
Genomic Location:
Chromosome 9 (position 10995847)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGCAAGCATGCTGAAGGCTGTCATTCTTATCGGAGGCCCCCAAAAAGG[T/G]GAGTAAACATCCGTCTGACWCTTTTCAGCAGTTCRGATTGACATYATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003543 Essential Splice Site 46 422 2 12
Genomic Location:
Chromosome 9 (position 10996499)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGCCGGAGTGCCAATGCTGCAGCATCACATTGAGGCCTGCTCTAAGG[T/A]AAAGTACTCATTTTACACTTTGAAAACAATATGATATATTAGCACATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003543 Essential Splice Site 254 422 8 12
Genomic Location:
Chromosome 9 (position 11000404)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATTTTGTAGTTGCTGTATTATGTTAGTKATTGTTATGTTCTACTTTC[A/T]GATCTGCGATTTATGCAAGCCGTTTGTATCTGAATCAATATCAYAAGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link