numbl

Ensembl ID:
ENSDARG00000024043
ZFIN ID:
ZDB-GENE-051113-340
Description:
numb homolog [Source:RefSeq peptide;Acc:NP_001012375]
Human Orthologue:
NUMBL
Human Description:
numb homolog (Drosophila)-like [Source:HGNC Symbol;Acc:8061]
Mouse Orthologue:
Numbl
Mouse Description:
numb-like Gene [Source:MGI Symbol;Acc:MGI:894702]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13223 Essential Splice Site Available for shipment Available now
sa42504 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039454 Essential Splice Site 67 618 3 9
ENSDART00000121845 Essential Splice Site 89 640 3 9
Genomic Location (Zv9):
Chromosome 15 (position 13740374)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14521337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCAGAGGSATGCATGTGTGTGAAGAGGCAGTRAAAAAGCTRAAAGTGG[T/G]GAGTATCGGATCCTCACAKTATAAAACATACGCTTGCTGTAAAAAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039454 Nonsense 191 618 6 9
ENSDART00000121845 Nonsense 213 640 6 9
Genomic Location (Zv9):
Chromosome 15 (position 13754120)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14507591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAACATCATTTGTGAGGGAAGGTTCATTCCGCGTGTCCTCCGCCGCA[C/T]AACAGAGTGACCGTGAGGACATCATGAAGCAGATTCAAGACAAGAAGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link