coch

Ensembl ID:
ENSDARG00000024032
ZFIN IDs:
ZDB-GENE-030616-403, ZDB-GENE-030616-403
Description:
cochlin [Source:RefSeq peptide;Acc:NP_001003823]
Human Orthologue:
COCH
Human Description:
coagulation factor C homolog, cochlin (Limulus polyphemus) [Source:HGNC Symbol;Acc:2180]
Mouse Orthologue:
Coch
Mouse Description:
coagulation factor C homolog (Limulus polyphemus) Gene [Source:MGI Symbol;Acc:MGI:1278313]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23099 Nonsense Available for shipment Available now
sa12192 Nonsense Available for shipment Available now
sa36439 Nonsense Mutation detected in F1 DNA During 2016
sa23098 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000948 Nonsense 4 553 2 12
ENSDART00000129448 Nonsense 4 553 1 11
Genomic Location (Zv9):
Chromosome 17 (position 28808213)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28732140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAATGCTCTTTTGTCTCTACAGAAATCTTCATTAACCATGTCGTTGTG[G/A]TTTGCTGTCCTTCATGTTTTAGGTAGGTGATTTGTTTAATTGAAGCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000948 Nonsense 56 553 4 12
ENSDART00000129448 Nonsense 56 553 3 11
Genomic Location (Zv9):
Chromosome 17 (position 28807424)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28731351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTCAGACACACATCTGCTGGTGCTCTGWCCAGCAAACTGCTCTCTGTG[G/A]AGCCTCTCAGTGTTTGGTTCTGGAGTTTATGCCTCTATTTCCAGCATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000948 Nonsense 188 553 8 12
ENSDART00000129448 Nonsense 188 553 7 11
Genomic Location (Zv9):
Chromosome 17 (position 28806178)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28730105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTTGTTGCTGGATAGCAGCTACAACATCGGACAGCGGCGGTTCAACT[T/A]GCAGAAGAACTTTGTCAGTAAACTTGCAACCATGCTGAAGGTTGGGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000948 Nonsense 213 553 8 12
ENSDART00000129448 Nonsense 213 553 7 11
Genomic Location (Zv9):
Chromosome 17 (position 28806104)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28730031
KASP Assay ID:
2261-1171.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAACCATGCTGAAGGTTGGGACACAAGGTCCTCATGTAGGAGTGGTG[C/T]AAACCAGGTGATCTGTGCATAAACACAAGTCATTTATCATAGTGAGCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link