sdf2

Ensembl ID:
ENSDARG00000024026
ZFIN ID:
ZDB-GENE-030131-8823
Description:
stromal cell-derived factor 2 [Source:RefSeq peptide;Acc:NP_956333]
Human Orthologue:
SDF2
Human Description:
stromal cell-derived factor 2 [Source:HGNC Symbol;Acc:10675]
Mouse Orthologue:
Sdf2
Mouse Description:
stromal cell derived factor 2 Gene [Source:MGI Symbol;Acc:MGI:108019]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43657 Essential Splice Site Mutation detected in F1 DNA During 2017
sa132 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa43657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034875 Essential Splice Site 59 222 2 3
Genomic Location (Zv9):
Chromosome 21 (position 25419781)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25989599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCACATAAATTAATTAATATAAATGTGTTATTATGATTTTGTAATTGC[A/T]GGTAGTGGTCAGCAGTCAGTGACAGGTGTGACCACAGTGGAGGACAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa132
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034875 Nonsense 90 222 2 3
Genomic Location (Zv9):
Chromosome 21 (position 25419687)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25989505
KASP Assay ID:
554-0862.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTAACAGTTACTGGAGTGTTCGGGGCACCAGTGATCACTCATGTCAT[C/T]GAGGGACTCCTGTACGTTGTGGACAAAATATCCGACTGACCCATGTGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link