mamdc1

Ensembl ID:
ENSDARG00000024017
ZFIN ID:
ZDB-GENE-030616-360
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q7ZZ84]
Human Orthologue:
MDGA2
Human Description:
MAM domain containing glycosylphosphatidylinositol anchor 2 [Source:HGNC Symbol;Acc:19835]
Mouse Orthologue:
Mdga2
Mouse Description:
MAM domain containing glycosylphosphatidylinositol anchor 2 Gene [Source:MGI Symbol;Acc:MGI:2444706]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4714 Nonsense Mutation detected in F1 DNA During 2015
sa9344 Nonsense Mutation detected in F1 DNA During 2015
sa28871 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa4714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033943 Nonsense 384 957 7 17
Genomic Location:
Chromosome 17 (position 28520975)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGCTCATGTTTAGCTGGCTGAAGAAYGGCCGTCCTCTCCGCAGCTCA[G/T]AGCGCATGGTCATTACCCAGACTGACCCGGACGTCGCCCCAGGAACCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033943 Nonsense 428 957 7 17
Genomic Location:
Chromosome 17 (position 28521107)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTGGCACGTACACCTGTGTGGCCTCGCTGAAGAACGGTGGKATACCA[G/T]AGATTAGCATAGACGTCAACATCTCCYCCACCACGGGTGAGTTTTTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033943 Nonsense 637 957 10 17
Genomic Location:
Chromosome 17 (position 28564797)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTCTTTTTTTTATTTTAGGTAAAGCATTTGCTCCTGAGTTCTTTTA[T/A]GATACCTACAGCGCACTGTGGCAAAACAAACCTCGTGTCTACGGCTTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r5y4x1mj