mamdc1

Ensembl ID:
ENSDARG00000024017
ZFIN ID:
ZDB-GENE-030616-360
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q7ZZ84]
Human Orthologue:
MDGA2
Human Description:
MAM domain containing glycosylphosphatidylinositol anchor 2 [Source:HGNC Symbol;Acc:19835]
Mouse Orthologue:
Mdga2
Mouse Description:
MAM domain containing glycosylphosphatidylinositol anchor 2 Gene [Source:MGI Symbol;Acc:MGI:2444706]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4714 Nonsense Mutation detected in F1 DNA During 2014
sa9344 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033943 Nonsense 384 957 7 17
Genomic Location:
Chromosome 17 (position 28520975)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGCTCATGTTTAGCTGGCTGAAGAAYGGCCGTCCTCTCCGCAGCTCA[G/T]AGCGCATGGTCATTACCCAGACTGACCCGGACGTCGCCCCAGGAACCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033943 Nonsense 428 957 7 17
Genomic Location:
Chromosome 17 (position 28521107)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTGGCACGTACACCTGTGTGGCCTCGCTGAAGAACGGTGGKATACCA[G/T]AGATTAGCATAGACGTCAACATCTCCYCCACCACGGGTGAGTTTTTCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r5y4x1mj