cacna1da

Ensembl ID:
ENSDARG00000024004
ZFIN ID:
ZDB-GENE-030616-135
Description:
voltage-dependent L-type calcium channel subunit alpha-1D [Source:RefSeq peptide;Acc:NP_982351]
Human Orthologue:
CACNA1D
Human Description:
calcium channel, voltage-dependent, L type, alpha 1D subunit [Source:HGNC Symbol;Acc:1391]
Mouse Orthologue:
Cacna1d
Mouse Description:
calcium channel, voltage-dependent, L type, alpha 1D subunit Gene [Source:MGI Symbol;Acc:MGI:88293]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1422 Essential Splice Site Available for shipment Available now
sa17298 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058276 Essential Splice Site 494 1716 13 40
ENSDART00000089956 Essential Splice Site 860 2083 22 50
ENSDART00000100118 Essential Splice Site 835 2069 21 50
Genomic Location:
Chromosome 11 (position 37699880)
KASP Assay ID:
554-1343.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCATTGGCTGCTGAGGATCCAATCAGAAACTTCTCTGCTAGGAAYATTG[T/A]GAGTATTACCACAGTAATGCCAAGATTATACAGTAAAGTYCAAACCATTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa17298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058276 None None 1716 None 40
ENSDART00000089956 None None 2083 None 50
ENSDART00000100118 Essential Splice Site 855 2069 22 50
Genomic Location:
Chromosome 11 (position 37698393)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCAGATTATGTCYTCACTAGTATGTTTACATTTGAGATCGTGTTAAAG[G/A]TAACCTTTCGGCACACAGGCCTGGCTGCATTATCYCCATRTGTGTCACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Insulin resistance/response: Genome-wide detection of allele specific copy number variation associated with insulin resistance in African Americans from the HyperGEN study. (View Study)
  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
  • Ventricular conduction: Common variants in 22 loci are associated with QRS duration and cardiac ventricular conduction. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dwzbzgx8