heatr5a

Ensembl ID:
ENSDARG00000023999
ZFIN ID:
ZDB-GENE-030616-152
Description:
HEAT repeat-containing protein 5A [Source:UniProtKB/Swiss-Prot;Acc:Q8JFV4]
Human Orthologue:
HEATR5A
Human Description:
HEAT repeat containing 5A [Source:HGNC Symbol;Acc:20276]
Mouse Orthologue:
Heatr5a
Mouse Description:
HEAT repeat containing 5A Gene [Source:MGI Symbol;Acc:MGI:2444133]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6480 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14816 Nonsense Available for shipment Available now
sa14010 Nonsense Available for shipment Available now
sa16625 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032975 None None 1998 None 36
ENSDART00000109693 None None 111 None 4
ENSDART00000122260 Essential Splice Site 796 2040 15 36
ENSDART00000143607 None None 1991 None 35
Genomic Location:
Chromosome 17 (position 28699814)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTCCAGCTGTTTGGAGTGATTTTTCCCCACCTGAKTGTCCAGCAGAGG[T/C]ATTTCCTTCATYAGCACAGTGAGATCTGTTTAAAAGTTTAGTTGACACAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032975 Nonsense 1248 1998 25 36
ENSDART00000109693 None None 111 None 4
ENSDART00000122260 Nonsense 1290 2040 25 36
ENSDART00000143607 Nonsense 1241 1991 24 35
Genomic Location:
Chromosome 17 (position 28714339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGATCCGCATGGCDTTCATGGCATCCACAGACCACAGTGACCAGCTC[C/T]GACTGGCTGGTTTGCAAACGCTTCTGGTCATTATTCGTAAATTCTCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14010
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032975 Nonsense 1541 1998 30 36
ENSDART00000109693 None None 111 None 4
ENSDART00000122260 Nonsense 1583 2040 30 36
ENSDART00000143607 Nonsense 1534 1991 29 35
ENSDART00000032975 Nonsense 1541 1998 30 36
ENSDART00000109693 None None 111 None 4
ENSDART00000122260 Nonsense 1583 2040 30 36
ENSDART00000143607 Nonsense 1534 1991 29 35
Genomic Location:
Chromosome 17 (position 28719768)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTGTGCTCTCCTCATTCTGGAGACCAAATGGAAAACATTCATTCATG[T/A]CTTCAGGCTCTGCAGGCCTTATTGGAGGTGCCTTGGCCTCGCWCAAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032975 Nonsense 1541 1998 30 36
ENSDART00000109693 None None 111 None 4
ENSDART00000122260 Nonsense 1583 2040 30 36
ENSDART00000143607 Nonsense 1534 1991 29 35
ENSDART00000032975 Nonsense 1541 1998 30 36
ENSDART00000109693 None None 111 None 4
ENSDART00000122260 Nonsense 1583 2040 30 36
ENSDART00000143607 Nonsense 1534 1991 29 35
Genomic Location:
Chromosome 17 (position 28719768)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTGTGCTCTCCTCATTCTGGAGACCAAATGGAAAACATTCATTCATG[T/A]CTTCAGGCTCTGCAGGCCTTATTGGAGGTGCCTTGGCCTCGSWCAAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/evnwfexn