tpm4

Ensembl ID:
ENSDARG00000023963
ZFIN ID:
ZDB-GENE-040426-2185
Description:
tropomyosin alpha-4 chain isoform 2 [Source:RefSeq peptide;Acc:NP_998323]
Human Orthologue:
AC103988.1
Human Description:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JE83]
Mouse Orthologue:
Tpm3-rs7
Mouse Description:
tropomyosin 3, related sequence 7 Pseudogene [Source:MGI Symbol;Acc:MGI:99705]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11492 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009054 Nonsense 205 284 6 9
ENSDART00000036075 Nonsense 205 284 6 9
ENSDART00000123125 Nonsense 169 248 5 8
ENSDART00000138978 Nonsense 125 204 4 7
ENSDART00000142717 Nonsense 125 204 4 7
Genomic Location:
Chromosome 22 (position 15731122)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAAGCTAGTGATTTGGAGGAGGAATTGAAAAACRTTACCAACAACCTT[A/T]AATCCCTAGAGGCTCAGGCAGAGAAAGTAAGTCAACACCTCTGTTTTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8w4m1rs0