si:ch211-261f7.2

Ensembl ID:
ENSDARG00000023952
ZFIN ID:
ZDB-GENE-041014-11
Description:
Protein FAM167A [Source:UniProtKB/Swiss-Prot;Acc:Q5RFZ7]
Human Orthologue:
FAM167A
Human Description:
family with sequence similarity 167, member A [Source:HGNC Symbol;Acc:15549]
Mouse Orthologue:
Fam167a
Mouse Description:
family with sequence similarity 167, member A Gene [Source:MGI Symbol;Acc:MGI:3606565]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16272 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16272
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084420 Essential Splice Site None 204 None 3
ENSDART00000142196 Essential Splice Site None 204 None 3
Genomic Location (Zv9):
Chromosome 20 (position 18813291)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 18841548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCTCCCGAAGAGCAGGACGCGAAGTGCCTGACAAACTGCCATGAAGG[T/G]AAGACTCGACTTTTTCTTATGAGAAAATGTTCAGRCATWTATGAACTGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link