ENSDARG00000023940

Ensembl ID:
ENSDARG00000023940
Human Orthologue:
WASF3
Human Description:
WAS protein family, member 3 [Source:HGNC Symbol;Acc:12734]
Mouse Orthologue:
Wasf3
Mouse Description:
WAS protein family, member 3 Gene [Source:MGI Symbol;Acc:MGI:2658986]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24032 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047936 Nonsense 39 506 1 9
Genomic Location:
Chromosome 21 (position 42001038)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACCAACGAGCTGGAGTGTGTCACCAACAGCACACTGGCGGCCATCATC[A/T]AACAGCTCGGGGGACTCAGTACGTTCAATTTATTTACATTTACAGCTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t7j182jf