dnajc24

Ensembl ID:
ENSDARG00000023927
ZFIN ID:
ZDB-GENE-040426-1153
Description:
dnaJ homolog subfamily C member 24 [Source:RefSeq peptide;Acc:NP_956746]
Human Orthologue:
DNAJC24
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 24 [Source:HGNC Symbol;Acc:26979]
Mouse Orthologue:
Dnajc24
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 24 Gene [Source:MGI Symbol;Acc:MGI:1919522]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19360 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13340 Nonsense Available for shipment Available now
sa24626 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035714 Essential Splice Site None 149 1 5
Genomic Location (Zv9):
Chromosome 25 (position 15130804)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14773727
KASP Assay ID:
554-6227.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACGCTCATGACAGCTCGTTAAAAAGTGGAGAAATCGTTTAATGTTCGG[T/A]TAGTCAGCTCGACAGTTCTCTTGTTATATACTTTCATACGGTATAAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035714 Nonsense 68 149 3 5
Genomic Location (Zv9):
Chromosome 25 (position 15144345)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14787268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCAGCACCTGCAGCGATTCATTGACATYGACCAAGCTTGGAAGATCT[T/G]AAGTAAYGAGGAGAGCAGGAACGAGTACAATTTGCAGTTACGGGGTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035714 Nonsense 139 149 5 5
Genomic Location (Zv9):
Chromosome 25 (position 15158453)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 14801376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAAGACGAAACCCAAGAAGTGGAAACCGTTGTGTGCTGTGACTCCTG[T/A]TCGCTCAGCATTGAAGTAAAGAAGGGTACCTGACACTTTGGATGCTTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link