dnaja2

Ensembl ID:
ENSDARG00000023921
ZFIN ID:
ZDB-GENE-040426-2884
Description:
DnaJ subfamily A member 2 [Source:RefSeq peptide;Acc:NP_998658]
Human Orthologue:
DNAJA2
Human Description:
DnaJ (Hsp40) homolog, subfamily A, member 2 [Source:HGNC Symbol;Acc:14884]
Mouse Orthologue:
Dnaja2
Mouse Description:
DnaJ (Hsp40) homolog, subfamily A, member 2 Gene [Source:MGI Symbol;Acc:MGI:1931882]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21047 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21047
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029586 Nonsense 75 412 3 9
Genomic Location (Zv9):
Chromosome 7 (position 44642338)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41632638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATCCAGAGAAGAGGGATATGTATGACCGCTATGGGGAACAGGGTCTG[C/T]GAGAAGGTGGCTGTGGTGGAGGTGGGATGGATGACATCTTTTCCCACATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link