llgl2

Ensembl ID:
ENSDARG00000023920
ZFIN ID:
ZDB-GENE-030131-9877
Description:
Lethal(2) giant larvae protein homolog 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7SZE3]
Human Orthologue:
LLGL2
Human Description:
lethal giant larvae homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:6629]
Mouse Orthologue:
Llgl2
Mouse Description:
lethal giant larvae homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918843]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31887 Nonsense Available for shipment Available now
sa38900 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034550 Nonsense 373 1020 11 26
ENSDART00000127203   None 495 None 12

The following transcripts of ENSDARG00000023920 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 35253232)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33657341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAGCTGGTTGTGGTGGATCTGCAGACTGAAGGGTGGCCCGTCATC[C/T]AGACGCCATACCTGGTGCCATTACACTGTTCAGCCATCACTTGCTCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38900
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034550 Nonsense 403 1020 11 26
ENSDART00000127203   None 495 None 12

The following transcripts of ENSDARG00000023920 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 35253142)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33657251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGCTCACACCACGTCTCCTCCATCCCTCTCAAACTGTGGGAGAGAGTG[C/T]AAGCTGCGGGAGCCCACCAGAACACACACTACTCCAGGAAGGTATGCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link