ENSDARG00000023916

Ensembl ID:
ENSDARG00000023916
Mouse Orthologue:
Phactr1
Mouse Description:
phosphatase and actin regulator 1 Gene [Source:MGI Symbol;Acc:MGI:2659021]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa955 Essential Splice Site F2 line generated During 2014
sa1807 Splice Site F2 line generated During 2014
sa4929 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa23823 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa955
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014606 Essential Splice Site 56 490 1 22
Genomic Location:
Chromosome 20 (position 53126269)
KASP Assay ID:
554-0860.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAATGGAGAAAGAAAAAGAGCGACAAGTTCAAGCAGACRTCTGCAGG[T/C]ACAACACTGCACACTTCTGATGCTGTAGGAATTCCCCTTCAGCTCACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1807
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014606 Splice Site None 490 None 22
Genomic Location:
Chromosome 20 (position 53134892)
KASP Assay ID:
554-1799.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTCTCTACCRTACAGACTGACTGAATGAGTGAGTGTTGATCTGTGTGT[G/A]TCAGCAGACGAGGTCAGCGGTGACAGTGCTCGTGTGTGTGTGAGTGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014606 Splice Site, Nonsense 137 490 7 22
Genomic Location:
Chromosome 20 (position 53134897)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTACCRTACARACTGACTGAATGAGTGAGTGTTGATCTGTGTGTRTCAG[C/T]AGACGAGGTCAGCGGTGACAGTGCTCGTGTGTGTGTGAGTGATCTGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23823
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014606 Essential Splice Site 274 490 13 22
Genomic Location:
Chromosome 20 (position 53141835)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCGCCCCCTGTGAAGCCGTTACAGAGTGACAGCGCTGACATCAGTCAC[G/T]TGAGGCCGCCGTCGCTCAAGCAGCCGCCAGCCTTACCGCCAAAGCCATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nsm6s2xg