atf2l

Ensembl ID:
ENSDARG00000023903
ZFIN ID:
ZDB-GENE-030911-8
Human Orthologue:
ATF2
Human Description:
activating transcription factor 2 [Source:HGNC Symbol;Acc:784]
Mouse Orthologue:
Atf2
Mouse Description:
activating transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:109349]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41336 Essential Splice Site Mutation detected in F1 DNA During 2016
sa3731 Essential Splice Site Mutation detected in F1 DNA During 2016
sa27322 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062292 Essential Splice Site 32 504 1 11
ENSDART00000135180 Essential Splice Site 16 130 2 5
Genomic Location:
Chromosome 9 (position 2340041)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGAGTGATGATAAACCGTTCCTCTGCACTGCTCCTGGCTGCGGACAG[G/A]CATGTGATCTCTCTTAAAGCTCTAACACACATTTAAAGCTGCAGGGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062292 Essential Splice Site 273 504 7 11
ENSDART00000135180   None 130 None 5
Genomic Location:
Chromosome 9 (position 2353602)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCCCCGGCCCCGCCTCTCCACAGCCCRTCCAATCAGAAGCCAAGATGG[T/A]AACGTTCTCCTCATTTTGCATTTGCAYACACTCATGCTTCATTTGCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062292 Essential Splice Site 329 504 8 11
ENSDART00000135180   None 130 None 5
Genomic Location:
Chromosome 9 (position 2359696)
KASP Assay ID:
2260-1381.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGCCCAAAATCACTGCAGCAGCCTGCAACATCTACTACTGAAATACCC[G/A]TATGTAGACTGCAGAAATTATTTTCATACCATAGAGCAGGGGTGGGCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link