casd1

Ensembl ID:
ENSDARG00000023900
ZFIN ID:
ZDB-GENE-060503-329
Description:
CAS1 domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1LW89]
Human Orthologue:
CASD1
Human Description:
CAS1 domain containing 1 [Source:HGNC Symbol;Acc:16014]
Mouse Orthologue:
Casd1
Mouse Description:
CAS1 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2384865]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23580 Nonsense Mutation detected in F1 DNA During 2014
sa6566 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23580
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049842 None None 781 None 18
ENSDART00000138555 Nonsense 186 806 4 17
Genomic Location:
Chromosome 19 (position 41973620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCCTTTTGTCGATGGTGATTCCACTGTGGTAAGTGATTTTAATTTGTG[G/A]TTTCTTAAAGTTTGAGCAAATGTTGATTTTATTTAGATCCTTTTAATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049842 Essential Splice Site 413 781 9 18
ENSDART00000138555 Essential Splice Site 472 806 9 17
Genomic Location:
Chromosome 19 (position 41978295)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTAYATCTTCGTTCTGGGTGTCTTCTACAGTGAGAACAGCAAAGAGG[T/C]ACTGCAAATTTTARCCTGTATTTATASTCTCAAGTAGGGCTGYACAAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e3pn03u1