cacna2d4

Ensembl ID:
ENSDARG00000023886
Human Orthologue:
CACNA2D4
Human Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 4 [Source:HGNC Symbol;Acc:20202]
Mouse Orthologue:
Cacna2d4
Mouse Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 4 Gene [Source:MGI Symbol;Acc:MGI:2442632]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30239 Nonsense Mutation detected in F1 DNA During 2016
sa38055 Nonsense Mutation detected in F1 DNA During 2016
sa38054 Nonsense Mutation detected in F1 DNA During 2016
sa16578 Essential Splice Site Available for shipment Available now
sa38053 Essential Splice Site Mutation detected in F1 DNA During 2016
sa44276 Nonsense Mutation detected in F1 DNA During 2016
sa38052 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24655 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24654 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa30239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027465 Nonsense 24 1062 2 37
Genomic Location (Zv9):
Chromosome 25 (position 19574072)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18986049
KASP Assay ID:
2261-9611.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGGGCCCTCACCATTTCAGAGCAAATCAATGCAATTGCATCAAAGTA[T/A]TCAGGAGCTGCTCTCTTTCAAAAGGTAAACATAAATGGAAATGTTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027465 Nonsense 154 1062 6 37
Genomic Location (Zv9):
Chromosome 25 (position 19571231)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18983208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTTCAGTCATGTTTATTTGCAGATCCAGATATTCTCAATGGAGTGTA[C/A]ATGTCAGAGGCCTTGAACGACATCTTCATCAATAACTTCCAGAAAGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027465 Nonsense 188 1062 6 37
Genomic Location (Zv9):
Chromosome 25 (position 19571129)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18983106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCTCACCTGGCAGTATTTCTGCAGCCAAACGGGTTTCTTCAGACTTTA[T/A]CCAGGTTTAATCACTTCTGCTTAGTATTGCTTAGCAACTTTTAAGACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16578
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027465 Essential Splice Site 353 1062 11 37
Genomic Location (Zv9):
Chromosome 25 (position 19558485)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18970462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGATTTCCAGTCAGTTTTTGAGGAGTTCAACTGGCCTGACAAGAAG[G/A]TAACATAYAATCTGCTCACTCCACAGGGGAACGGAGGCCATAGCATATRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027465 Essential Splice Site 431 1062 14 37
Genomic Location (Zv9):
Chromosome 25 (position 19553046)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18965023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCATCTTAATCCTTTTTGCTATCAAACAGCTTCCTAACACTATGGAG[G/A]TAACTTAGTTAAACATTTTAGCATGTGTAAATAGAAATAGAGATGTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027465 Nonsense 788 1062 27 37
Genomic Location (Zv9):
Chromosome 25 (position 19529874)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18941851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATTTTTTTATTTTTTCTCTTTTTTTTTTCATTTTCAGCTATTGGAATG[C/T]AGGCGTCTCTAGACGTGCTGGAGAGAATATTCATGTCTATTGCCAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027465 Essential Splice Site 840 1062 29 37
Genomic Location (Zv9):
Chromosome 25 (position 19527765)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18939742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGTTGACAGTAATGGCTTCATACTGATGTCAAAGGATAGAGGAGATG[T/C]AAGTATATCATTACATGTCTTACATGGTGTTCACACTTGTAGTTTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027465 Essential Splice Site 926 1062 33 37
Genomic Location (Zv9):
Chromosome 25 (position 19520220)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18932197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGTTCAACATCTGTGGACTTTGGCATAATGACTATGTGGTGGATGG[T/A]AAGTTAAACTTTTAGTGATAATACTGTTAATTATCAGTGGAGTGGACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027465 Missense 1005 1062 36 37
Genomic Location (Zv9):
Chromosome 25 (position 19517016)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18928993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTTACACTTTTGTGTGAAAGTGCAGTTTTCTTAACTCCTCTGTACA[T/G]AACGCCACGGTGAAGTGCAACAGGATGAAATCTCAGAAGATCCGCAGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link