cacna2d4

Ensembl ID:
ENSDARG00000023886
Human Orthologue:
CACNA2D4
Human Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 4 [Source:HGNC Symbol;Acc:20202]
Mouse Orthologue:
Cacna2d4
Mouse Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 4 Gene [Source:MGI Symbol;Acc:MGI:2442632]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4320 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16578 Essential Splice Site Available for shipment Available now
sa24655 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24654 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027465 Essential Splice Site 88 1062 4 37
Genomic Location:
Chromosome 25 (position 19573162)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTGCAGACACMGCTGAGGATGCTGACCTGTATCATGAATTTAATTCA[T/A]CTTTACAGGTAAATTTAAAYATTTATATACAGTTGAAGTCAGAATTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16578
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027465 Essential Splice Site 353 1062 11 37
Genomic Location:
Chromosome 25 (position 19558485)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGATTTCCAGTCAGTTTTTGAGGAGTTCAACTGGCCTGACAAGAAG[G/A]TAACATAYAATCTGCTCACTCCACAGGGGAACGGAGGCCATAGCATATRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027465 Essential Splice Site 926 1062 33 37
Genomic Location:
Chromosome 25 (position 19520220)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGTTCAACATCTGTGGACTTTGGCATAATGACTATGTGGTGGATGG[T/A]AAGTTAAACTTTTAGTGATAATACTGTTAATTATCAGTGGAGTGGACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027465 Missense 1005 1062 36 37
Genomic Location:
Chromosome 25 (position 19517016)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTTACACTTTTGTGTGAAAGTGCAGTTTTCTTAACTCCTCTGTACA[T/G]AACGCCACGGTGAAGTGCAACAGGATGAAATCTCAGAAGATCCGCAGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/df9512ji