lsm4

Ensembl ID:
ENSDARG00000023852
ZFIN ID:
ZDB-GENE-040426-1652
Description:
U6 snRNA-associated Sm-like protein LSm4 [Source:RefSeq peptide;Acc:NP_956990]
Human Orthologue:
LSM4
Human Description:
LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Source:HGNC Symbol;Acc:17259]
Mouse Orthologue:
Lsm4
Mouse Description:
LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:135469

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41776 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037824 Essential Splice Site 115 143 4 6
Genomic Location (Zv9):
Chromosome 11 (position 6947674)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 6855168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAAGGGCAGAGGAGGTGGACCTGGAAGAGGCGGCGGACCTGGCAGAG[G/A]TCTGATGCTTTTATATTCATACAATAGATCATATCATATAATCATTCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link