uvrag

Ensembl ID:
ENSDARG00000023815
ZFIN ID:
ZDB-GENE-040426-924
Description:
UV radiation resistance-associated gene protein [Source:RefSeq peptide;Acc:NP_957363]
Human Orthologue:
UVRAG
Human Description:
UV radiation resistance associated gene [Source:HGNC Symbol;Acc:12640]
Mouse Orthologue:
Uvrag
Mouse Description:
UV radiation resistance associated gene Gene [Source:MGI Symbol;Acc:MGI:1925860]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6176 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11829 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028161 Essential Splice Site 75 664 2 15
ENSDART00000129395 Essential Splice Site 75 693 2 15
ENSDART00000134056 None None 281 None 9
Genomic Location:
Chromosome 10 (position 33435886)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACACTTACTTCACCCTCCACCTCTGCCAGGATGATCAGATATCACGAG[G/A]TGACTGATGCCACTCTCTGATTGTTCCAATAATTTAGTGCTTAACGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028161 Nonsense 432 664 14 15
ENSDART00000129395 Nonsense 461 693 14 15
ENSDART00000134056 None None 281 None 9
Genomic Location:
Chromosome 10 (position 33236639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGACTTTACCCAACTTGAAGAACTTCCTWGAGCATGGGCTGCTCGTA[C/T]GATGGTAAGTTACAGCATTAATACTGCTCTATGTGAAGGTATGGATGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v7ni5t3l