uvrag

Ensembl ID:
ENSDARG00000023815
ZFIN ID:
ZDB-GENE-040426-924
Description:
UV radiation resistance-associated gene protein [Source:RefSeq peptide;Acc:NP_957363]
Human Orthologue:
UVRAG
Human Description:
UV radiation resistance associated gene [Source:HGNC Symbol;Acc:12640]
Mouse Orthologue:
Uvrag
Mouse Description:
UV radiation resistance associated gene Gene [Source:MGI Symbol;Acc:MGI:1925860]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6176 Essential Splice Site Mutation detected in F1 DNA During 2015
sa11829 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028161 Essential Splice Site 75 664 2 15
ENSDART00000129395 Essential Splice Site 75 693 2 15
ENSDART00000134056   None 281 None 9
Genomic Location:
Chromosome 10 (position 33435886)
KASP Assay ID:
554-4589.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACACTTACTTCACCCTCCACCTCTGCCAGGATGATCAGATATCACGAG[G/A]TGACTGATGCCACTCTCTGATTGTTCCAATAATTTAGTGCTTAACGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028161 Nonsense 432 664 14 15
ENSDART00000129395 Nonsense 461 693 14 15
ENSDART00000134056   None 281 None 9
Genomic Location:
Chromosome 10 (position 33236639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGACTTTACCCAACTTGAAGAACTTCCTWGAGCATGGGCTGCTCGTA[C/T]GATGGTAAGTTACAGCATTAATACTGCTCTATGTGAAGGTATGGATGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v7ni5t3l