NP_001096041.1

Ensembl ID:
ENSDARG00000023797
Description:
ryanodine receptor 1b (skeletal) [Source:RefSeq peptide;Acc:NP_001096041]
Human Orthologue:
RYR1
Human Description:
ryanodine receptor 1 (skeletal) [Source:HGNC Symbol;Acc:10483]
Mouse Orthologue:
Ryr1
Mouse Description:
ryanodine receptor 1, skeletal muscle Gene [Source:MGI Symbol;Acc:MGI:99659]

Alleles

There are 20 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8908 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8792 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8832 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13194 Essential Splice Site Available for shipment Available now
sa39208 Nonsense Mutation detected in F1 DNA During 2017
sa23341 Nonsense Available for shipment Available now
sa10230 Essential Splice Site Available for shipment Available now
sa23340 Nonsense Available for shipment Available now
sa43145 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14191 Nonsense Available for shipment Available now
sa14094 Essential Splice Site Available for shipment Available now
sa43144 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23339 Nonsense Available for shipment Available now
sa23338 Nonsense Available for shipment Available now
sa6529 Nonsense Mutation detected in F1 DNA During 2017
sa9444 Nonsense Available for shipment Available now
sa2983 Nonsense F2 line generated During 2017
sa36692 Nonsense Available for shipment Available now
sa23337 Nonsense Available for shipment Available now
sa39207 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33992223)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35671379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGCTTTAGATGCTAAAGCGGCTCGCCTGGGAACCATGAARAGAAGGG[T/G]AATGAAGCTCAGTTAATTCCAAACCACATGATAACAAAACATGTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33992223)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35671379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGCTTTAGATGCTAAAGCGGCTCGCCTGGGAACCATGAARAGAAGGG[T/G]AATGAAGCTCAGTTAATTCCAAACCACATGATAACAAAACATGTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33992223)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35671379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGCTTTAGATGCTAAAGCGGCTCGCCTGGGAACCATGAARAGAAGGG[T/G]AATGAAGCTCAGTTAATTCCAAACCACATGATAACAAAACATGTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 880 5060 21 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33973879)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35653647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCTASTGTTGGATACCTTCNNNNNAAAATGAATAAAYGTGAACTCTCTTTCA[G/A]TTCAGGGATGATAATAAGAAGTTGCACCCGTGTCTRGTGGACTTTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 1020 5060 24 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33967327)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35647095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGTCTGGTGCCTTACAATTTGCTAGACGAGAGAACCAAGAAGACCAAC[C/T]GAGACAGTGTGAACAATGCTGTACGCACTTTGATTGGTTACGGATATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 1066 5060 25 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33965873)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35645641
KASP Assay ID:
2261-2415.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGATGTGCATGGAGATAAAGTGAGAATCTTCAGGGCAGAGAAGCAGTA[T/A]GGTGTTACCTCAGGAAAATGGTATTTTGAGTTCGAGGCTGTAACTACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 1113 5060 25 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33965730)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35645498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGAGCTTGGTTCTGATGAGTTGGCCTATGTCTTCAATGGAAACAGGG[T/G]CAGTATTGTCATACTTTTATATWYCAGGCAATCCACCTTTCAARATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 1247 5060 28 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33959261)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35639033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGACCTTCTTAATTGCTATCATTGAACCTTTAGGTCTCTCGTGTGGAT[G/T]GAACTGTAGACAGTGCTCCCTGTATAAAAATTACCCACAAGACGTTCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 1403 5060 30 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33956612)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35636384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCTAGTTTTCTCTGTTAAGTATCTTTCTCCCTCTGTGTCCATTGTGC[A/T]GTACTATTACTCGGTTCGTATCTTCGCTGGACAAGAGCCTAGCGAGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 1527 5060 32 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33952604)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35633161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCCCAACACTAAGCTCTTTCCAGCTGTGTTTGTTCTTCCAAGCAGC[C/T]AAAACATGCTCCAGCTGGAACTTGGAAAACTCAAGGTCAGCGCATCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 2049 5060 37 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33944614)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35625171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCGAGAAACCCACAACAATTTCCACAATGACCTCCTGAATCACTGTGG[T/A]MAGTGTTGACAGTTTTCCTCAGTTGCTTTGATACTTTTCKTATGTAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 2303 5060 42 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757   None 2712 None 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33937662)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35618219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAACAATGAGCTGGCACTGGCCCTGCAAGAGCAAGACCTTGAAATGG[T/A]ATTATTAAAATACATTTGTCTTGTTTGCAGAATAAATAAAAATTTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 2432 5060 45 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757 Nonsense 84 2712 2 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33934199)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35615041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCACGAAGAGAATAGATTACATCTTGGAAATGCTATTATGTCATTTTA[T/A]TCTGCCCTTATTGACTTGCTGGGTCGCTGTGCTCCTGAGATGCATGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 3314 5060 67 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757 Nonsense 966 2712 24 61
ENSDART00000146076 Nonsense 38 215 1 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33906509)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35587351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACTTCCCAGAGCAGGAAGGCTGTCTGTGCACCGACGTCACCTCCGAA[C/T]AACTCAATCAACTCCTGGGAAGCATCATGAAGATTGTCGTCAACAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 3727 5060 78 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757 Nonsense 1379 2712 35 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33889068)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35569910
KASP Assay ID:
554-4276.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGWTCTCCTCACTGCAGCAAACTTGAAGTGGATCATCTATATATGTCATA[T/A]GCTGATATTATGGCAAAAGTAAGTACATAAACGTWTYTTTTGATACCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 3757 5060 79 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757 Nonsense 1409 2712 36 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33888895)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35569737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAYGAAGGGGGAGAGGAGGGGGGCGTGGAGCCATCCTTTGAGGTGCGA[C/T]WGACAGAGATGGTATGGGGGGGCCTGGGGCTGGGGCCATGGGAGTCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2983
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 4164 5060 89 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757 Nonsense 1816 2712 46 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33854555)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35535397
KASP Assay ID:
554-3338.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCAACCTGTCTGAGCATGTTCCTCATGACACTCGCTTGCAGAACTTCT[T/A]GGAACAAGCTGAGAGTGTGCTCAACTACTTCCGCCCCTTCCTGGGCCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 4180 5060 89 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757 Nonsense 1832 2712 46 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33854508)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35535350
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTGGAACAAGCTGAGAGTGTGCTCAACTACTTCCGCCCCTTCCTGGGC[C/T]GAATCGAGATCATGGGTGCTAGCAAAAGGATTGAACGTATCTACTTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 4709 5060 94 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757 Nonsense 2361 2712 51 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33848005)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35528847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAGAGAGAGAAGGAGCTGGCCCGTAAACTGGAGTTTGATGGTCTGTA[T/A]GTAACTGAACAACCAGAAGATGACGACATCAAGGGCCAGTGGGACCGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 5050 5060 104 104
ENSDART00000138178   None 164 None 6
ENSDART00000142757 Nonsense 2702 2712 61 61
ENSDART00000146076   None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33835818)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35516660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAAATGTACCAGGAGCGATGCTGGGACTTCTTTCCTGCTGGTGACTG[T/A]TTTAGGAAGCAGTATGAGGATCAGCTTGGCTAATTTCAACTAGCAGCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link