GABRB3

Ensembl ID:
ENSDARG00000023771
Description:
gamma-aminobutyric acid (GABA) A receptor, beta 3 [Source:HGNC Symbol;Acc:4083]
Human Orthologue:
GABRB3
Human Description:
gamma-aminobutyric acid (GABA) A receptor, beta 3 [Source:HGNC Symbol;Acc:4083]
Mouse Orthologue:
Gabrb3
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit beta 3 Gene [Source:MGI Symbol;Acc:MGI:95621]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38563 Nonsense Mutation detected in F1 DNA During 2016
sa17383 Essential Splice Site Available for shipment Available now
sa40740 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087300 Nonsense 50 532 2 11
Genomic Location:
Chromosome 6 (position 38351631)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGAATAGTAACATCACTTCCTTTTCTGTTTTGCAGGAATGCTGTGGAT[G/T]GAAATAAAAAGCTGTTTGCAATTTATGACACAAGGTAAGTGTGTATGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087300 Essential Splice Site 216 532 6 11
Genomic Location:
Chromosome 6 (position 38405181)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGGYATCCATTAGATGAGCAGAATTGCACTCTGGAGATTGAGAGTTG[T/G]AAGTGTTCTCTCTCTTCACTCGTCTACAYATTTCCTGCTGCAAAGACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087300 Nonsense 527 532 11 11
Genomic Location:
Chromosome 6 (position 38442747)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACGGATTATATTTCCCGCAGTTTTCTCGCTTTTCAACTTGATCTATTG[G/A]CTGTATTATGTGAATTAGGCCTCAGGCGTCCGTTGGGTTTTTTTGGCCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link