mfsd4a

Ensembl ID:
ENSDARG00000023768
ZFIN ID:
ZDB-GENE-040426-1643
Description:
Major facilitator superfamily domain-containing protein 4-A [Source:UniProtKB/Swiss-Prot;Acc:Q7SXB7]
Human Orthologue:
MFSD4
Human Description:
major facilitator superfamily domain containing 4 [Source:HGNC Symbol;Acc:25433]
Mouse Orthologue:
Mfsd4
Mouse Description:
major facilitator superfamily domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2442786]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35147 Nonsense Mutation detected in F1 DNA During 2016
sa12832 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029157 Nonsense 36 456 1 9
Genomic Location (Zv9):
Chromosome 11 (position 39669360)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 38167660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCACCCTCATTATCTCTGTGGTTTTTGCCATCATCCCATTATGCCGC[G/T]AGCTTCTCATGTTGGCGTTTGCCATGGCAGTGTCTGGTCTTGCCATGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12832
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029157 Nonsense 66 456 1 9
Genomic Location (Zv9):
Chromosome 11 (position 39669452)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 38167752
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCATGGGCAYCATCGACACCATCTCTAACCTGCAGCTGGTCAAGATCTA[C/A]CAGAAAGACTCCACYGTTTTCCTGCAGGTSAGCGTTTGGTTTGGTCTNGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link