gnsa

Ensembl ID:
ENSDARG00000023766
ZFIN ID:
ZDB-GENE-050107-5
Description:
N-acetylglucosamine-6-sulfatase [Source:RefSeq peptide;Acc:NP_001025379]
Human Orthologue:
GNS
Human Description:
glucosamine (N-acetyl)-6-sulfatase [Source:HGNC Symbol;Acc:4422]
Mouse Orthologue:
Gns
Mouse Description:
glucosamine (N-acetyl)-6-sulfatase Gene [Source:MGI Symbol;Acc:MGI:1922862]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17618 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028694 Essential Splice Site 194 538 5 14
Genomic Location:
Chromosome 4 (position 4388861)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCGGCACGGACAAAACTACAGCGAGGATTACCTTACAGATGTYCTGG[T/C]AGGAGCAGATCTTGTGTTYATRAAATTACAGAACAGMGAATGATCTACCY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nttxm185