cdc42se1

Ensembl ID:
ENSDARG00000023724
ZFIN ID:
ZDB-GENE-030131-9260
Description:
CDC42 small effector protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6TEL3]
Human Orthologue:
CDC42SE1
Human Description:
CDC42 small effector 1 [Source:HGNC Symbol;Acc:17719]
Mouse Orthologue:
Cdc42se1
Mouse Description:
CDC42 small effector 1 Gene [Source:MGI Symbol;Acc:MGI:1889510]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10753 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031895 Nonsense 44 75 3 5
ENSDART00000130403 Nonsense 44 75 2 3
Genomic Location:
Chromosome 16 (position 40985563)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCATGATCGGAGAGCCCACAAACTTCGTTCATCTGACACACATAGGCT[C/A]GGGTGAAATGGCAGATGGCATSCAGCCGGTAAGACATGCTTTATTGTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wpimg8um