mao

Ensembl ID:
ENSDARG00000023712
ZFIN ID:
ZDB-GENE-040329-3
Description:
Amine oxidase [flavin-containing] [Source:UniProtKB/Swiss-Prot;Acc:Q6NSN2]
Human Orthologues:
MAOA, MAOB
Human Descriptions:
monoamine oxidase A [Source:HGNC Symbol;Acc:6833]
monoamine oxidase B [Source:HGNC Symbol;Acc:6834]
Mouse Orthologues:
Maoa, Maob
Mouse Descriptions:
monoamine oxidase A Gene [Source:MGI Symbol;Acc:MGI:96915]
monoamine oxidase B Gene [Source:MGI Symbol;Acc:MGI:96916]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21528 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21527 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3730 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028225 Essential Splice Site 49 522 3 15
Genomic Location:
Chromosome 9 (position 34656001)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTGGCTTGTCTGAGTTTCACTAACAACTTTATCACCTGTGTAATTTC[A/T]GAATAAGGAGACCAAATGGGTGGATCTGGGAGGAGCGTACATTGGACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028225 Essential Splice Site 361 522 10 15
Genomic Location:
Chromosome 9 (position 34626783)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTGGCACGAAAATCACGGAAGCTGGCAAATCTGACGAGGGATGAAAG[G/A]TAGATTTTTATTTCTTCACATATTATTAAATGTCACTATACTGTGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028225 Essential Splice Site 450 522 13 15
Genomic Location:
Chromosome 9 (position 34626254)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTTACATGGAGGGGGCCGTGCAGGCGGGAGAGAGAGCCTCTAGAGAG[G/A]TACATTCACACACAGCRGGGTTTAGTTACTGAAATCAAAGTCATTTGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q4n6k6ub