ENSDARG00000023692

Ensembl ID:
ENSDARG00000023692
Human Orthologues:
ANKRD28, ANKRD44, ANKRD50, ANKRD52
Human Descriptions:
ankyrin repeat domain 28 [Source:HGNC Symbol;Acc:29024]
ankyrin repeat domain 44 [Source:HGNC Symbol;Acc:25259]
ankyrin repeat domain 50 [Source:HGNC Symbol;Acc:29223]
ankyrin repeat domain 52 [Source:HGNC Symbol;Acc:26614]
Mouse Orthologues:
Ankrd28, Ankrd44, Ankrd50, Ankrd52, E230028L10Rik
Mouse Descriptions:
ankyrin repeat domain 28 Gene [Source:MGI Symbol;Acc:MGI:2145661]
ankyrin repeat domain 44 Gene [Source:MGI Symbol;Acc:MGI:3045243]
ankyrin repeat domain 50 Gene [Source:MGI Symbol;Acc:MGI:2139777]
ankyrin repeat domain 52 Gene [Source:MGI Symbol;Acc:MGI:2444029]
RIKEN cDNA E230028L10 gene Gene [Source:MGI Symbol;Acc:MGI:2685285]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16639 Nonsense Available for shipment Available now
sa4778 Essential Splice Site F2 line generated During 2014
sa23408 Nonsense Available for shipment Available now
sa4082 Nonsense Mutation detected in F1 DNA During 2014
hu3429 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
sa16639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103179 Nonsense 508 1404 14 28
Genomic Location:
Chromosome 19 (position 1555025)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATAGAATGGATTTTCAGTTTGACTTGAAGCTGGCGCCGCCTGCTGRT[C/T]AAAACAGTGTAAGTGCAGTACAGTCTGGCCACGCATGTTTTCATGCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4778
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103179 Essential Splice Site 813 1404 22 28
Genomic Location:
Chromosome 19 (position 1563601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATTACAWGTGTCTATATATGGTTTGTAACTTGTCCATGTGTGTKTTC[A/C]GAGTGGCTGGACAGCGCTGCATTACGCTGCTGAAGCCGGCTGTCTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103179 Nonsense 868 1404 22 28
Genomic Location:
Chromosome 19 (position 1563768)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTACGCGGCTCAGCAGAACCACGAGTCCGCTGTCATATTCCTGCTC[A/T]GACGAGAGAAAAACACACTCCGGCTGCTGGACGACAAGAAGGTCAGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103179 Nonsense 957 1404 23 28
Genomic Location:
Chromosome 19 (position 1565319)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAGCTCATGGCGTCCGATCTGCTGTCTCTATCTGCATCTGCTGGGGGT[C/T]AGGGAGCTGGCGCAGGCCCCATACTKAGGGCTCTGGACCACAGGGGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3429
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103179 Nonsense 990 1404 23 28
Genomic Location:
Chromosome 19 (position 1565418)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTGTGTTGGACTGCCTGATCGAGGGCCGGCAGAAGGGCGTGGTATCC[C/T]AACCGGCAGTGCAGACGTACCTGACGGAGGTGTGGTGTGGAGGTCTGCAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cg1box46