cacna1f

Ensembl ID:
ENSDARG00000023683
ZFIN ID:
ZDB-GENE-031104-1
Description:
Novel protein similar to vertebrate voltage-dependent calcium channel P/Q type alpha 1 subunit (CACN
Human Orthologue:
CACNA1F
Human Description:
calcium channel, voltage-dependent, L type, alpha 1F subunit [Source:HGNC Symbol;Acc:1393]
Mouse Orthologue:
Cacna1f
Mouse Description:
calcium channel, voltage-dependent, alpha 1F subunit Gene [Source:MGI Symbol;Acc:MGI:1859639]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41191 Nonsense Mutation detected in F1 DNA During 2016
sa34385 Nonsense Mutation detected in F1 DNA During 2016
sa1442 Essential Splice Site F2 line generated During 2016
sa14371 Essential Splice Site Available for shipment Available now
sa10599 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041564 Nonsense 182 2126 5 55
ENSDART00000134151 Nonsense 244 1612 5 40
ENSDART00000136403   None 313 None 5
Genomic Location:
Chromosome 8 (position 23735734)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTGTGTGTGTGTCTGTGTGTGTGTTTGCAGGCCTACAGATTGTGT[T/A]AAACTCCATCATGAAGGCGATGGTTCCCCTGTTGCACATTTCTTTGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041564 Nonsense 542 2126 13 55
ENSDART00000134151 Nonsense 575 1612 13 40
ENSDART00000136403   None 313 None 5
Genomic Location:
Chromosome 8 (position 23744086)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAGGTTCTACTCTCGTTGTTCACGGTGGAGATGCTGTTGAAAATGTA[C/A]AGTCTGGGGTTGCAGGTTTATTTCGTCGCGTTTTTCAACCGTTTTGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1442
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041564 Essential Splice Site 1449 2126 40 55
ENSDART00000134151 Essential Splice Site 1429 1612 35 40
ENSDART00000136403   None 313 None 5
Genomic Location:
Chromosome 8 (position 23762681)
KASP Assay ID:
554-1368.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGGATGAGTTTAAAAGAATCTGGTCAGAGTACGACCCAGAAGCCAAG[T/G]AAGACTATCAGTTTCTCTTAAACTTTTTAATCTATTTAAACCAGAAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041564 Essential Splice Site 1481 2126 41 55
ENSDART00000134151 Essential Splice Site 1461 1612 36 40
ENSDART00000136403   None 313 None 5
Genomic Location:
Chromosome 8 (position 23762854)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACCGCTTGGATTTGGGAAGCTCTGTCCTCATCGTGTGGCCTGCAAGG[T/C]ACAGACACGCATACACAGAGTCATTTGCKATGATTTCTCTTTCTATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041564 Nonsense 1905 2126 52 55
ENSDART00000134151   None 1612 None 40
ENSDART00000136403 Nonsense 95 313 3 5
Genomic Location:
Chromosome 8 (position 23771647)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATACAGTGTTTAAGAAGGCAAGGCAGCAGCGATGATCTGCCCATTCCA[G/T]GAAYCTATCATCAGAACTCGCCGCCCTGCAGAGCACGCTCACAGGTAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link