idh3g

Ensembl ID:
ENSDARG00000023648
ZFIN ID:
ZDB-GENE-050417-435
Description:
Zgc:113076 protein [Source:UniProtKB/TrEMBL;Acc:Q566P0]
Human Orthologue:
IDH3G
Human Description:
isocitrate dehydrogenase 3 (NAD+) gamma [Source:HGNC Symbol;Acc:5386]
Mouse Orthologue:
Idh3g
Mouse Description:
isocitrate dehydrogenase 3 (NAD+), gamma Gene [Source:MGI Symbol;Acc:MGI:1099463]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43986 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13461 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034953   None 66 None 5
ENSDART00000103989 Essential Splice Site 42 391 3 14
Genomic Location (Zv9):
Chromosome 23 (position 25421409)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25207529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTATTTGCTTCCTCCAATCCTGGTTTGTATGAAGGGGCGAATCATAG[T/A]AAGTATAAAGCAACATATAAGTAAACGATAAACCGTCAATTCCCATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034953   None 66 None 5
ENSDART00000103989 Nonsense 78 391 5 14
Genomic Location (Zv9):
Chromosome 23 (position 25421107)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25207227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATATGTCTCYANTGCTAAGAACTGCCTKTACAATCATAGGTTCAGCTG[T/A]GTTCCTGTGGAYTTTGAAGTTGTTCATGTAAATWCTYCATCAACCAGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link