ccbl1

Ensembl ID:
ENSDARG00000023645
ZFIN ID:
ZDB-GENE-040426-2676
Description:
cysteine conjugate-beta lyase; cytoplasmic [Source:RefSeq peptide;Acc:NP_998524]
Human Orthologue:
CCBL1
Human Description:
cysteine conjugate-beta lyase, cytoplasmic [Source:HGNC Symbol;Acc:1564]
Mouse Orthologue:
Ccbl1
Mouse Description:
cysteine conjugate-beta lyase 1 Gene [Source:MGI Symbol;Acc:MGI:1917516]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33646 Essential Splice Site Mutation detected in F1 DNA During 2017
sa26513 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004797 Essential Splice Site 215 446 None 14
ENSDART00000126999 Essential Splice Site 189 426 None 13
ENSDART00000143435   None 43 None 2
ENSDART00000145222   None 73 None 4

The following transcripts of ENSDARG00000023645 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 34887610)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32669559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGGTCAAGTATGTCCAGCCTAAGCTTAACCTTCTTCTTTATTTACCC[A/C]GGTCTATCAATGGGAGGAACTTCAGGTTATTGCAGACTTATGCATTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004797   None 446 None 14
ENSDART00000126999 Nonsense 422 426 13 13
ENSDART00000143435   None 43 None 2
ENSDART00000145222   None 73 None 4

The following transcripts of ENSDARG00000023645 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 34884040)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32665989
KASP Assay ID:
2259-6100.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATTGGTAGGATTTTTTGAAAGGTTTTGGAAAGAAATGTCTTCTGCCTG[C/A]CAAGGTTGCATTTGTTTGCAAAACTTTATTTAGGACACGTTTAATGAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link