epha8

Ensembl ID:
ENSDARG00000023609
ZFIN ID:
ZDB-GENE-041014-269
Description:
Novel protein similar to vertebrate Eph family of receptors [Source:UniProtKB/TrEMBL;Acc:Q5SPQ0]
Human Orthologue:
EPHA8
Human Description:
EPH receptor A8 [Source:HGNC Symbol;Acc:3391]
Mouse Orthologue:
Epha8
Mouse Description:
Eph receptor A8 Gene [Source:MGI Symbol;Acc:MGI:109378]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21965 Nonsense Available for shipment Available now
sa35149 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa21965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041800 Nonsense 764 1027 13 17
ENSDART00000136107 Nonsense 466 729 12 16
Genomic Location (Zv9):
Chromosome 11 (position 40099557)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 38600967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTCTCTCCTCCTGCAAACAGAGACACGACGGTCAGTTCACCATTATT[C/T]AGCTGGTTGGGATTCTGCGTGGCATCGCGGCTGGCATGACTTACTTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041800 Essential Splice Site 875 1027 15 17
ENSDART00000136107 Essential Splice Site 577 729 14 16
Genomic Location (Zv9):
Chromosome 11 (position 40101993)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 38603403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGCAATATCTCACATATAAATTCTTTCTTTTTTTTTTTTTTTTACCTC[A/G]GGTGATCAAGTCCGTAGAGGAGGGTTACCGTCTCCCAGCCCCCATGGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link