epha8

Ensembl ID:
ENSDARG00000023609
ZFIN ID:
ZDB-GENE-041014-269
Description:
Novel protein similar to vertebrate Eph family of receptors [Source:UniProtKB/TrEMBL;Acc:Q5SPQ0]
Human Orthologue:
EPHA8
Human Description:
EPH receptor A8 [Source:HGNC Symbol;Acc:3391]
Mouse Orthologue:
Epha8
Mouse Description:
Eph receptor A8 Gene [Source:MGI Symbol;Acc:MGI:109378]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7677 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21965 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041800 Essential Splice Site 520 1027 6 17
ENSDART00000136107 Essential Splice Site 212 729 4 16
Genomic Location:
Chromosome 11 (position 40081987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRCAGCCTAACGGAGTCATATTAGAGTATGACATCAAATATTACGAAAAG[G/A]TAATTCCTACATCAGCACCGATAAATTCCCAATCCTGCAGGAGTGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041800 Nonsense 764 1027 13 17
ENSDART00000136107 Nonsense 466 729 12 16
Genomic Location:
Chromosome 11 (position 40099557)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTCTCTCCTCCTGCAAACAGAGACACGACGGTCAGTTCACCATTATT[C/T]AGCTGGTTGGGATTCTGCGTGGCATCGCGGCTGGCATGACTTACTTGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/49kfu5ej