sh3gl2

Ensembl ID:
ENSDARG00000023600
ZFIN ID:
ZDB-GENE-040121-3
Description:
endophilin-A1 [Source:RefSeq peptide;Acc:NP_957410]
Human Orthologue:
SH3GL2
Human Description:
SH3-domain GRB2-like 2 [Source:HGNC Symbol;Acc:10831]
Mouse Orthologue:
Sh3gl2
Mouse Description:
SH3-domain GRB2-like 2 Gene [Source:MGI Symbol;Acc:MGI:700009]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19508 Nonsense Available for shipment Available now
sa12612 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090611 Nonsense 170 347 6 9
Genomic Location (Zv9):
Chromosome 1 (position 25715161)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26055378
KASP Assay ID:
2259-0639.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAGCATCACCTGAAGAAGCTGGAGGGGCGACGATTGGACTTTGACTA[T/A]AAGAAGAAAAGGCAAGGAAAAGTCACAGAGGATGAGATCAAACAGGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090611 Nonsense 211 347 7 9
Genomic Location (Zv9):
Chromosome 1 (position 25714192)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26054409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCATGTGTTACAGTTAWTAATGTTCTAACTGTGTTTCACCAGATTGAG[C/T]AAGTGAGTCAGCTTTCTGCTCTGGTCCAAGCTCAAGTCAACTACCATAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cognitive performance: A genome-wide study of common SNPs and CNVs in cognitive performance in the CANTAB. (View Study)
  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)
  • Normalized brain volume: Genome-wide association analysis of susceptibility and clinical phenotype in multiple sclerosis. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Parkinson's disease: Meta-analysis of Parkinson's disease: identification of a novel locus, RIT2. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link