ftr64

Ensembl ID:
ENSDARG00000023597
ZFIN IDs:
ZDB-GENE-090508-8, ZDB-GENE-090508-8
Description:
FinTRIM family protein [Source:UniProtKB/TrEMBL;Acc:B5WXY5]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12729 Nonsense Available for shipment Available now
sa25315 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa2248 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa12729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035360 Nonsense 230 486 3 6
ENSDART00000111921 None None 102 None 2
Genomic Location:
Chromosome 5 (position 62736866)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGTTGATGAAATGAAAAGGAGAGACTCTGAGATGAAGCAGCTTTTA[C/T]AAACAGACGATCACATATACTTCYTGCAGGTAGCTTCTCTTAAAGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035360 Nonsense 341 486 6 6
ENSDART00000111921 Splice Site None 102 None 2
Genomic Location:
Chromosome 5 (position 62740691)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACGCCTTCGCCTGTCTGAAGGAAACAAACAGGCCTTCGACAGCGGCT[C/A]AGTCCAGCCGTATCCCGATCATCCAGACAGATTTGATCAGCACCTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2248
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035360 Nonsense 374 486 6 6
ENSDART00000111921 None None 102 None 2
Genomic Location:
Chromosome 5 (position 62740790)
KASP Assay ID:
554-3309.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCTGAGCAGAGAGAGTGTGTGCGGACGCTGCTACTGGGAGCTSGACT[G/A]GAGCGGMAGTGGCGGACTCGCCGTTTCAGTGGCGTACAAGAGCATCAGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bceunvfm