cdc7

Ensembl ID:
ENSDARG00000023584
ZFIN ID:
ZDB-GENE-041114-113
Description:
cell division cycle 7-related protein kinase [Source:RefSeq peptide;Acc:NP_001007410]
Human Orthologue:
CDC7
Human Description:
cell division cycle 7 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:1745]
Mouse Orthologue:
Cdc7
Mouse Description:
cell division cycle 7 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1309511]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32853 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034246   None 549 None 11
ENSDART00000100607 Essential Splice Site None 459 1 11
ENSDART00000138718   None 491 None 11
Genomic Location (Zv9):
Chromosome 2 (position 10668764)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11093860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTCTCATAAACAATAACAGACTTGGAGAAAACATAAACAATAAAAG[G/T]TAAAGTTTTACAACTTATTTTCCGCGATACATTTCGACGCTTTGTTTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link