lpp

Ensembl ID:
ENSDARG00000023578
ZFIN ID:
ZDB-GENE-040426-918
Description:
lipoma-preferred partner homolog [Source:RefSeq peptide;Acc:NP_957492]
Human Orthologue:
LPP
Human Description:
LIM domain containing preferred translocation partner in lipoma [Source:HGNC Symbol;Acc:6679]
Mouse Orthologue:
Lpp
Mouse Description:
LIM domain containing preferred translocation partner in lipoma Gene [Source:MGI Symbol;Acc:MGI:2441

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3577 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031253 Nonsense 231 556 6 11
ENSDART00000126203 Nonsense 231 556 4 9
ENSDART00000136898 None None 142 None 3
ENSDART00000146876 Nonsense 231 330 6 6
Genomic Location:
Chromosome 6 (position 28275957)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCCACCTTYAATGTTCAGGTSAGGGCTGCTCAGCCTGCCCCTCAGCAG[C/T]AACCRGTGCGTGGTCCAGGACAGGTACAGTACATGCCGGCTCAACCCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6b7zjisc