cdh7

Ensembl ID:
ENSDARG00000023542
ZFIN ID:
ZDB-GENE-061019-3
Description:
cadherin-7 [Source:RefSeq peptide;Acc:NP_001070916]
Human Orthologue:
CDH7
Human Description:
cadherin 7, type 2 [Source:HGNC Symbol;Acc:1766]
Mouse Orthologue:
Cdh7
Mouse Description:
cadherin 7, type 2 Gene [Source:MGI Symbol;Acc:MGI:2442792]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5141 Nonsense Mutation detected in F1 DNA During 2014
sa19774 Nonsense Mutation detected in F1 DNA During 2014
sa13502 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030547 Nonsense 158 787 2 11
ENSDART00000122029 Nonsense 158 787 2 13
ENSDART00000128466 Nonsense 172 801 2 11

The following transcripts of ENSDARG00000023542 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 27181612)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGATATTAATGACAATGAGCCCAAGTTCCTGGATGGTCCTTATAATGCA[C/T]AAGTGCCAGAAATGTCTCCTGTTGGTAAGTGCTTTTTTATTTGCTCTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030547 Nonsense 223 787 4 11
ENSDART00000122029 Nonsense 223 787 4 13
ENSDART00000128466 Nonsense 237 801 4 11

The following transcripts of ENSDARG00000023542 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 27197213)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTGCGGACAGCTCTGCCCAACATGGACCGAGAAGCACGGGACCAATA[T/A]CTTCTAGTAATCCAGGCCAAAGACATGGTTGGCCAGATGGGAGGACTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030547 Nonsense 605 787 10 11
ENSDART00000122029 Nonsense 605 787 10 13
ENSDART00000128466 Nonsense 619 801 10 11

The following transcripts of ENSDARG00000023542 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 27224241)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAGTCGTGTGGCACAGAGGCCTTCATGCTGTCAGCAGGACTCAGCACC[G/T]GAGCAYTCATCGCCATCCTTGCCTGCATCATCACCCTGCTTGGTAGGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac Troponin-T levels: Association of genome-wide variation with highly sensitive cardiac troponin-T levels in European Americans and Blacks: a meta-analysis from atherosclerosis risk in communities and cardiovascular health studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jh2rogqt