ahr1b

Ensembl ID:
ENSDARG00000023537
ZFIN ID:
ZDB-GENE-050922-1
Description:
aryl hydrocarbon receptor [Source:RefSeq peptide;Acc:NP_001019987]
Human Orthologue:
AHR
Human Description:
aryl hydrocarbon receptor [Source:HGNC Symbol;Acc:348]
Mouse Orthologue:
Ahr
Mouse Description:
aryl-hydrocarbon receptor Gene [Source:MGI Symbol;Acc:MGI:105043]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32390 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37460 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37459 Essential Splice Site Mutation detected in F1 DNA During 2016
sa188 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa32390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028787 Essential Splice Site 232 940 6 11
Genomic Location (Zv9):
Chromosome 22 (position 13126176)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12962106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTGTGTGTCGTTTCCGATGCCTCCTAGACAATTCCTCAGGATTCCTG[G/T]TCAGTGTCAACAAGCTATGCTAAGCTAAAGTATCCATTTTGCTATTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37460
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028787 Essential Splice Site 233 940 7 11
Genomic Location (Zv9):
Chromosome 22 (position 13124787)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12960717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTTTTGTATATTGATATTCCAGTAATTGTTTGTACTTGTATTCTTGA[A/T]GGCTTTGAATTTTCAAGGACGTCTGAAATTCCTGCATGGGCAAAACAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028787 Essential Splice Site 300 940 8 11
Genomic Location (Zv9):
Chromosome 22 (position 13124476)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12960406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAATATAATATGGTACAAACATCAGCGATGTTGTTCTGCCTGTTTTTT[A/C]GGGGTAAAATAGTTCTTGGCTACACAGAGGCGGAACTGCGAGTTCGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa188
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028787 Nonsense 368 940 9 11
Genomic Location (Zv9):
Chromosome 22 (position 13123409)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12959339
KASP Assay ID:
554-1011.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAAGGACAACCGTTGGAAATGGGTACAAGCTAATGCTAGACTTGTCTA[C/A]AAAAATGGCAAGCCTGACTACATCATTGCCACCCAGAGGCCACTTGTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link