nnt

Ensembl ID:
ENSDARG00000023536
ZFIN ID:
ZDB-GENE-040426-2592
Description:
NAD(P) transhydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_999921]
Human Orthologue:
NNT
Human Description:
nicotinamide nucleotide transhydrogenase [Source:HGNC Symbol;Acc:7863]
Mouse Orthologue:
Nnt
Mouse Description:
nicotinamide nucleotide transhydrogenase Gene [Source:MGI Symbol;Acc:MGI:109279]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39325 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037664 Essential Splice Site 617 1079 13 22
Genomic Location (Zv9):
Chromosome 21 (position 18624014)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19759503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTGGTGGTTATGGAGTTGCTCTTCAAAGCGGTTACAACATTGAACAG[G/A]TAAAACGCTGTCACATAAAAGAATAGTCCACCTAAAACTAAAATTGACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link