pinx1

Ensembl ID:
ENSDARG00000023532
ZFIN ID:
ZDB-GENE-030515-2
Description:
pin2-interacting protein X1 [Source:RefSeq peptide;Acc:NP_001013283]
Mouse Orthologue:
Pinx1
Mouse Description:
PIN2/TERF1 interacting, telomerase inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1919650]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23666 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032998 Nonsense 81 322 5 8
ENSDART00000126981 Nonsense 71 349 3 6
ENSDART00000128435 Nonsense 77 355 4 7
Genomic Location (Zv9):
Chromosome 20 (position 19080356)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19108613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCACATTTATTCAGTCTTGTTGCTTTTTTGTGTCATTAGGATAACTG[G/A]ATAGCCCACCAGGATGATTTTAATCAACTCCTTGCTGACCTTAACAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link