fgf17

Ensembl ID:
ENSDARG00000023520
ZFIN ID:
ZDB-GENE-040621-1
Description:
Fibroblast growth factor 17 [Source:UniProtKB/Swiss-Prot;Acc:Q6SJP8]
Human Orthologue:
FGF17
Human Description:
fibroblast growth factor 17 [Source:HGNC Symbol;Acc:3673]
Mouse Orthologue:
Fgf17
Mouse Description:
fibroblast growth factor 17 Gene [Source:MGI Symbol;Acc:MGI:1202401]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34519 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029630 Nonsense 145 215 5 5
ENSDART00000141334 Nonsense 134 155 5 5
Genomic Location (Zv9):
Chromosome 8 (position 54958141)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52747203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTACGGAAATCGTGTTGGAGAACAACTACACGGCTTTAGAGAACGCC[A/T]GACATGAGGGCTGGTTCGTGGCTTTCACCAGGAAGGGTCGACCCATCCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link