ctage5

Ensembl ID:
ENSDARG00000023516
ZFIN ID:
ZDB-GENE-040426-872
Description:
CTAGE family, member 5 [Source:RefSeq peptide;Acc:NP_956605]
Human Orthologues:
CTAGE1, CTAGE4, CTAGE5, CTAGE8, CTAGE9
Human Descriptions:
CTAGE family, member 4 [Source:HGNC Symbol;Acc:24772]
CTAGE family, member 5 [Source:HGNC Symbol;Acc:7057]
CTAGE family, member 8 [Source:HGNC Symbol;Acc:37294]
CTAGE family, member 9 [Source:HGNC Symbol;Acc:37275]
cutaneous T-cell lymphoma-associated antigen 1 [Source:HGNC Symbol;Acc:24346]
Mouse Orthologue:
Ctage5
Mouse Description:
CTAGE family, member 5 Gene [Source:MGI Symbol;Acc:MGI:1346056]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23018 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23017 Nonsense Mutation detected in F1 DNA During 2014
sa4001 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19166 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028311 Essential Splice Site None 691 1 25
Genomic Location:
Chromosome 17 (position 12935658)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACATGTTGACCATATTCCTAACGTGATTGATTTTACGGATTTTATAGG[T/A]ACAAAAATCAAGCTGTCCTTGGTATTAGCTTTGTTTAACTGTTTATAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028311 Nonsense 196 691 10 25
Genomic Location:
Chromosome 17 (position 12930405)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTATCATATTTTTTATTCCAGTCGCTCACAGAGTGCCTTTTGAAGATG[C/T]GAGATTGGGATTCAGAGGACGAGACCAGCATCGACGGCAGCACTAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028311 Essential Splice Site 268 691 12 25
ENSDART00000028311 Essential Splice Site 268 691 12 25
Genomic Location:
Chromosome 17 (position 12929957)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTCGCCAAACTTGCAGATGAAATTAAAGCCAAAGAAGATCTCCATGG[T/A]AAATCATYTGCATCCACTACAATTGAAACAGGTTTTAAGATGCATGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028311 Essential Splice Site 268 691 12 25
ENSDART00000028311 Essential Splice Site 268 691 12 25
Genomic Location:
Chromosome 17 (position 12929957)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTCGCCAAACTTGCAGATGAAATTAAAGCCAAAGAAGATCTCCATGG[T/A]AAATCATTTGCATCCACTACAATTGAAACAGGTTTTAAGATGCATGAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Tuberculosis: Genome-wide association analyses identifies a susceptibility locus for tuberculosis on chromosome 18q11.2. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/100uhc1r