ctage5

Ensembl ID:
ENSDARG00000023516
ZFIN ID:
ZDB-GENE-040426-872
Description:
CTAGE family, member 5 [Source:RefSeq peptide;Acc:NP_956605]
Human Orthologues:
CTAGE1, CTAGE4, CTAGE5, CTAGE8, CTAGE9
Human Descriptions:
CTAGE family, member 4 [Source:HGNC Symbol;Acc:24772]
CTAGE family, member 5 [Source:HGNC Symbol;Acc:7057]
CTAGE family, member 8 [Source:HGNC Symbol;Acc:37294]
CTAGE family, member 9 [Source:HGNC Symbol;Acc:37275]
cutaneous T-cell lymphoma-associated antigen 1 [Source:HGNC Symbol;Acc:24346]
Mouse Orthologue:
Ctage5
Mouse Description:
CTAGE family, member 5 Gene [Source:MGI Symbol;Acc:MGI:1346056]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23018 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23017 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028311 Essential Splice Site None 691 1 25
Genomic Location (Zv9):
Chromosome 17 (position 12935658)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACATGTTGACCATATTCCTAACGTGATTGATTTTACGGATTTTATAGG[T/A]ACAAAAATCAAGCTGTCCTTGGTATTAGCTTTGTTTAACTGTTTATAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23017
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028311 Nonsense 196 691 10 25
Genomic Location (Zv9):
Chromosome 17 (position 12930405)
KASP Assay ID:
2261-0746.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTATCATATTTTTTATTCCAGTCGCTCACAGAGTGCCTTTTGAAGATG[C/T]GAGATTGGGATTCAGAGGACGAGACCAGCATCGACGGCAGCACTAATATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Tuberculosis: Genome-wide association analyses identifies a susceptibility locus for tuberculosis on chromosome 18q11.2. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link