gmppab

Ensembl ID:
ENSDARG00000023498
ZFIN ID:
ZDB-GENE-040426-1550
Description:
Mannose-1-phosphate guanyltransferase alpha-B [Source:UniProtKB/Swiss-Prot;Acc:Q7SXP8]
Human Orthologue:
GMPPA
Human Description:
GDP-mannose pyrophosphorylase A [Source:HGNC Symbol;Acc:22923]
Mouse Orthologue:
Gmppa
Mouse Description:
GDP-mannose pyrophosphorylase A Gene [Source:MGI Symbol;Acc:MGI:1916330]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7032 Essential Splice Site Mutation detected in F1 DNA During 2017
sa26706 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032331 Essential Splice Site 46 422 2 12
Genomic Location (Zv9):
Chromosome 6 (position 13416935)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 13274214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTAGCAGGAGTTCCAATGCTGCAACATCACATTGAAGCCTGTGCCCAA[G/A]TRAGATACTWTACAGTTTTAAGTTATGTTTWGGKCACATGTCCATATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032331 Nonsense 59 422 3 12
Genomic Location (Zv9):
Chromosome 6 (position 13417153)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 13274432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCTTTACAGGTTCCTGATATGAAGGAGATCATACTAATAGGCTTTTA[T/G]CAGCCCAACGATGAGCTGAACCGCTTCATTTATTCTGCTCAGCAGGAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link