si:ch211-12e13.2

Ensembl ID:
ENSDARG00000023479
ZFIN ID:
ZDB-GENE-060526-27
Description:
Novel protein containing multiple low-density lipoprotein receptors domain class A, low-density lipo

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20347 Essential Splice Site Available for shipment Available now
sa33533 Nonsense Mutation detected in F1 DNA During 2017
sa16114 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007453 Essential Splice Site 546 1002 9 24
ENSDART00000134896 Essential Splice Site 546 1355 9 21
ENSDART00000147000   None 201 None 4

The following transcripts of ENSDARG00000023479 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 9595707)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8697579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTCATGGTTATGTTCTGGAACCTGATGGCCACAGCTGCAAAATCACAG[G/A]TGTATATGTGCTGCAGTTCATAATGCTAATGTTTTTGTTGTTGTTGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007453 Nonsense 658 1002 11 24
ENSDART00000134896 Nonsense 658 1355 11 21
ENSDART00000147000   None 201 None 4

The following transcripts of ENSDARG00000023479 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 9593075)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8694947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGATCAATGCTGTGAGGCTGGACAGTGAGATCGGCAGATCAACAGAT[C/T]GAGTCATGATCCTGGGAGAAGATCTGGGACAGCTGCGCTCCATCGCCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16114
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007453 Nonsense 712 1002 12 24
ENSDART00000134896 Nonsense 712 1355 12 21
ENSDART00000147000   None 201 None 4

The following transcripts of ENSDARG00000023479 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 9591042)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8692914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATGGACGGTTCAGACAGACGTGTGCTGGTCAGTAAATCTCTGCGGTG[G/A]CCGGTCAGTCTGACCGTCGACTCSCTGCAWCAAAGGATCTACTGGACTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link