CTNNB1

Ensembl ID:
ENSDARG00000023472
Description:
catenin (cadherin-associated protein), beta 1, 88kDa [Source:HGNC Symbol;Acc:2514]
Human Orthologue:
CTNNB1
Human Description:
catenin (cadherin-associated protein), beta 1, 88kDa [Source:HGNC Symbol;Acc:2514]
Mouse Orthologues:
AC165274.1, Ctnnb1
Mouse Description:
catenin (cadherin associated protein), beta 1 Gene [Source:MGI Symbol;Acc:MGI:88276]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43353 Nonsense Mutation detected in F1 DNA During 2016
sa23605 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081675 Nonsense 77 742 2 17
ENSDART00000123771 Nonsense 77 741 1 14
Genomic Location:
Chromosome 19 (position 49732440)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGCTGTACGAGTGGGAGCAGGGCTTCAGCCAGCCCTTCACACCTGAG[C/T]AGGTGGCAGGTACGCCAATGCCTTCGCCACAGCACACTGACTATAATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23605
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081675 Essential Splice Site 713 742 16 17
ENSDART00000123771 Essential Splice Site 712 741 13 14
Genomic Location:
Chromosome 19 (position 49722938)
KASP Assay ID:
2261-3759.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTGGATATCGGTGCTCCAGGAGAGACACTCGCATACAGAGCAGACGG[T/C]ACCTCATTACATCAATACATTACCGCTGTATAGAGATATTATACATCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link