galnt14

Ensembl ID:
ENSDARG00000023448
ZFIN ID:
ZDB-GENE-041014-351
Description:
polypeptide N-acetylgalactosaminyltransferase 14 [Source:RefSeq peptide;Acc:NP_001038460]
Human Orthologue:
GALNT14
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14) [So
Mouse Orthologue:
Galnt14
Mouse Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 Gene [Source:MGI

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37118 Nonsense Mutation detected in F1 DNA During 2017
sa37119 Essential Splice Site Mutation detected in F1 DNA During 2017
sa29422 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032161 Nonsense 47 554 2 15
Genomic Location (Zv9):
Chromosome 20 (position 38070512)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38142924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACATGTAAAACCAATCTGACCGCAGTGTTTTCATTATGTTGTAGATCT[C/A]AGATACTGAGTGGGATGACCTGCTGGAAGAGTTTGAAGAGAAAAGCTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032161 Essential Splice Site 220 554 6 15
Genomic Location (Zv9):
Chromosome 20 (position 38108298)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38180710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGTCAACAAAGATTGGCTGCCTCCACTGCTGCAGAGGGTCAAAGAGG[T/C]ACCATTTTATATTCAGTTTTGTTGTGTTCAAAGTCTGCTAAGAAATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032161 Nonsense 432 554 13 15
Genomic Location (Zv9):
Chromosome 20 (position 38128779)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38201191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGATGATTCTGATGCCAAGTCTGGTGTGATCCGGCAGAGACAGAACTG[T/A]CTAGAGTCTCGAGTAGTCGAAGGCCAGGATCTCCCAGTGCTCACACTCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • HIV-1 viral setpoint: Genomewide association study for determinants of HIV-1 acquisition and viral set point in HIV-1 serodiscordant couples with quantified virus exposure. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link