atp2b3b

Ensembl ID:
ENSDARG00000023445
ZFIN ID:
ZDB-GENE-080409-2
Description:
plasma membrane calcium-transporting ATPase 3 [Source:RefSeq peptide;Acc:NP_001121714]
Human Orthologue:
ATP2B3
Human Description:
ATPase, Ca++ transporting, plasma membrane 3 [Source:HGNC Symbol;Acc:816]
Mouse Orthologue:
Atp2b3
Mouse Description:
ATPase, Ca++ transporting, plasma membrane 3 Gene [Source:MGI Symbol;Acc:MGI:1347353]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10773 Essential Splice Site Available for shipment Available now
sa43954 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24300 Nonsense Mutation detected in F1 DNA During 2016
sa37672 Nonsense Mutation detected in F1 DNA During 2016
sa18149 Nonsense Available for shipment Available now
sa24299 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37671 Nonsense Mutation detected in F1 DNA During 2016
sa43953 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10773
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092725 Essential Splice Site 307 1174 5 21

The following transcripts of ENSDARG00000023445 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 20181878)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTACTGGGAGCTGGAGAAGGAGAAGAGGAGAAGAAAGAGAAGAAAGG[T/C]AGGTGTAAAAAGCCAAAGCATCAAACACCAACCAAAACGCRCACACWCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092725 Essential Splice Site 447 1174 8 21

The following transcripts of ENSDARG00000023445 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 20172913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGGTCTTCCCCTCGCTGTTACCATCTCTCTGGCCTATTCGGTTAAGG[T/C]AAGACAGAGACCCAAGTGCACTGTGTGCGTGATAGATAACAGATTACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092725 Nonsense 598 1174 10 21

The following transcripts of ENSDARG00000023445 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 20171895)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCCATGAGCACTGTGGTGCAGATGCCGGATGGAAGCTTCCGACTCTA[C/A]AGCAAAGGAGCCTCTGAGATCGTTTTAAAAAAGTAAGTATGACAAGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092725 Nonsense 645 1174 11 21

The following transcripts of ENSDARG00000023445 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 20170224)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATGAGATGGTGAAGAAAGTGATTGAGCCTATGGCATGCGAAGGCCTG[C/T]GAACAATCTGCATCGGTTATCGTGATCTTCCTGGCGACCCAGAGCCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092725 Nonsense 651 1174 11 21

The following transcripts of ENSDARG00000023445 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 20170204)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATTGAGCCYATGGCATGCGAAGGCCTGCGAACAATCTGCAYCGGTTA[T/A]CGWGMTCTTCCTGGCGACCCAGAGCCTGAGTGGGAGAATGAAGCTGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092725 Essential Splice Site 776 1174 13 21

The following transcripts of ENSDARG00000023445 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 20168094)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGTTCTTGCACGTTCGTCCCCCACTGACAAACACACTCTTGTAAAAG[G/A]TGAGGTTCTCTTTCTAGCTTTTCTAATCTTATCTTATAGCCTTTCTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092725 Nonsense 784 1174 14 21

The following transcripts of ENSDARG00000023445 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 20163800)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGCTGGGTGATGATGTTGCTGTGTAGGCATCATTGACAGCACTGTGT[T/A]GGAGCAGAGACAGGTGGTGGCCGTAACCGGCGATGGGACCAATGACGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092725 Essential Splice Site 1167 1174 21 21

The following transcripts of ENSDARG00000023445 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 20127758)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCACTCTGTTTTCTTTCTGTGTACTCGTCCCCCCTCTGTCCTTGTGC[A/G]GATGCGGGTAGTGAAAGCGTTCCGTAGCTCCCTTTATGACGGAATCGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link