tjp2b

Ensembl ID:
ENSDARG00000023443
ZFIN ID:
ZDB-GENE-040718-58
Description:
tight junction protein 2b [Source:RefSeq peptide;Acc:NP_001002366]
Human Orthologue:
TJP2
Human Description:
tight junction protein 2 (zona occludens 2) [Source:HGNC Symbol;Acc:11828]
Mouse Orthologue:
Tjp2
Mouse Description:
tight junction protein 2 Gene [Source:MGI Symbol;Acc:MGI:1341872]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41135 Nonsense Mutation detected in F1 DNA During 2016
sa21212 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34328 Nonsense Mutation detected in F1 DNA During 2016
sa34329 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018739 Nonsense 196 371 6 9
ENSDART00000092355 Nonsense 214 389 4 7
ENSDART00000115057 Nonsense 239 1204 5 23
ENSDART00000136184 Nonsense 214 1179 4 22

The following transcripts of ENSDARG00000023443 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12000719)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11445482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGCAGGGGCCGGACGCTGGAGCGCGGGTCTAGCCCGGAGCCTCGATA[T/G]CAACGGCAGCACAGCAGAGGCCGCGGTGGAGGAAGCCCTGCTGGAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018739   None 371 None 9
ENSDART00000092355   None 389 None 7
ENSDART00000115057 Essential Splice Site 489 1204 9 23
ENSDART00000136184 Essential Splice Site 464 1179 8 22

The following transcripts of ENSDARG00000023443 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12021738)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11466501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGTAGAACCACAGGATGAAGAGCCACCACCACCGCCACCACCACCAC[G/A]TATGAACGTCATTTTGTAATTTCTTCATAGCTGATTGTAAAAACTGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018739   None 371 None 9
ENSDART00000092355   None 389 None 7
ENSDART00000115057 Nonsense 1097 1204 21 23
ENSDART00000136184 Nonsense 1072 1179 20 22

The following transcripts of ENSDARG00000023443 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12057079)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11501842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAAGACCCCTCAAAGAGGTCTTTCCTGGGCAAAGTCAAGGCCTTCGAG[C/T]AGATGGATCACTTCGCCCGCTCACAGAGGGTTCTGGAGATACAAGAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018739   None 371 None 9
ENSDART00000092355   None 389 None 7
ENSDART00000115057 Nonsense 1135 1204 22 23
ENSDART00000136184 Nonsense 1110 1179 21 22

The following transcripts of ENSDARG00000023443 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12058396)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11503159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAATTGCTCAGAAACATCCAGACATATACGCTGTTCCCATGAAGTCT[C/T]AGAAACTGGACCACAGCAGGCCACAACCTATCGGGTAAGAGCCTGAAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
  • Renal sinus fat : Heritability and genome-wide association analysis of renal sinus fat accumulation in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link