atg5

Ensembl ID:
ENSDARG00000023396
ZFIN ID:
ZDB-GENE-040801-149
Description:
autophagy protein 5 isoform 2 [Source:RefSeq peptide;Acc:NP_991181]
Human Orthologue:
ATG5
Human Description:
ATG5 autophagy related 5 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:589]
Mouse Orthologue:
Atg5
Mouse Description:
autophagy-related 5 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1277186]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22749 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029727 Nonsense 154 275 5 8
Genomic Location:
Chromosome 16 (position 8605340)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAACATAAAGGCCAGGTCATCAACGATATGCAGAAGAAAGACCATAAA[C/T]AACTGTGGATGGGTCTGCAGAATGGTAAGGACAAATATTTGACAAATATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Systemic lupus erythematosus: Genome-wide association study in a Chinese Han population identifies nine new susceptibility loci for systemic lupus erythematosus. (View Study)
  • Systemic lupus erythematosus: Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/50syybjl