nr5a1b

Ensembl ID:
ENSDARG00000023362
ZFIN ID:
ZDB-GENE-040702-6
Description:
nuclear receptor subfamily 5, group A, member 1b [Source:RefSeq peptide;Acc:NP_997999]
Human Orthologue:
NR5A1
Human Description:
nuclear receptor subfamily 5, group A, member 1 [Source:HGNC Symbol;Acc:7983]
Mouse Orthologue:
Nr5a1
Mouse Description:
nuclear receptor subfamily 5, group A, member 1 Gene [Source:MGI Symbol;Acc:MGI:1346833]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37234 Nonsense Mutation detected in F1 DNA During 2017
sa23855 Nonsense Available for shipment Available now
sa12365 Nonsense Available for shipment Available now
sa15009 Nonsense Available for shipment Available now
sa15470 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028265 Nonsense 25 502 2 7
Genomic Location (Zv9):
Chromosome 21 (position 7777675)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8185226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAAGAGATGTGTCCGGTGTGCGGGGATAAAGTTTCTGGCTATCATTA[T/A]GGTTTATTAACCTGCGAAAGCTGCAAGGTATTAAGTCAACCATTTAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23855
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028265 Nonsense 118 502 4 7
Genomic Location (Zv9):
Chromosome 21 (position 7783439)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8190990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCGGGCGTTAAAGCAGCAGAAGAAAGCTCTCATCCGGGCCAGTGGCT[T/G]AAAGATGGAAGCCACACCCCCTTTGCTGACGTCACCACAACCTGACTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028265 Nonsense 186 502 4 7
Genomic Location (Zv9):
Chromosome 21 (position 7783642)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8191193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCCTGAGTTTATCCGTCCCCATCCCGGCCCACACTCCTCTCCCAGCA[C/T]AATACCCCTATCCAAATCTGCCCAGCCGTGCCATAAARTCTGAGTAWCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028265 Nonsense 201 502 4 7
Genomic Location (Zv9):
Chromosome 21 (position 7783689)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8191240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAYAATACCCCTATCCAAATCTGCCCAGCCGTGCCATAAARTCTGAGTA[T/A]CCTGACCACTACACAAGCTCAGAGCATTACACCAGTGCCAGCTCCCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028265 Essential Splice Site 419 502 6 7
Genomic Location (Zv9):
Chromosome 21 (position 7813209)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8220760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCGCAGAGAAACCGCCTGCCKCAAATACCTCATCCTCTTTAAYCCCGG[T/C]GAGAATCATAAAGCTAATTCAYTTACGCACATTTTAATRTTAAAGTACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link